Fabry disease-associated globotriaosylceramide induces mechanical allodynia via activation of signaling through proNGF-p75 NTR but not mature NGF-TrkA

Fabry disease-associated globotriaosylceramide induces mechanical allodynia via activation of signaling through proNGF-p75 NTR but not mature NGF-TrkA

Fabry disease-associated globotriaosylceramide induces mechanical allodynia via activation of signaling through proNGF-p75 NTR but not mature NGF-TrkA

Fabry illness (FD) is an X-linked metabolic storage dysfunction arising from the deficiency of lysosomal α-galactosidase A, which ends up in the gradual accumulation of glycosphingolipids, primarily globotriaosylceramide (Gb3), all through the physique. Ache within the extremities is an early symptom of FD; nevertheless, the underlying pathophysiological mechanisms stay unknown. α-Galactosidase A knockout animals exhibit nociceptive behaviors, with enhanced expression ranges of a number of ion channels.

These traits are noticed in animals handled with nerve development issue (NGF). Right here, we aimed to elucidate the potential of NGF signaling as a reason behind FD-associated ache, utilizing intraplantar Gb3-treated mice displaying mechanical allodynia. Remedy with a neutralizing antibody towards a precursor of NGF (proNGF) or its receptor, p75 neurotrophin receptor (p75NTR), resulted within the restoration from Gb3-induced ache.

Conversely, anti-NGF and anti-tropomyosin receptor kinase A antibodies did not exert analgesic results. Gb3 injection had no results on the expression ranges of proNGF and p75NTR within the plantar pores and skin and dorsal root ganglia, suggesting that Gb3 prompts the ache pathway, presumably mediated via useful up-regulation of proNGF-p75NTR signaling.

Moreover, by pharmacological approaches utilizing a protein kinase A (PKA) inhibitor and a cholesterol-removing agent, we discovered that p75NTR-phosphorylating PKA and lipid rafts for phosphorylated p75NTR translocation have been required for Gb3-induced ache. These outcomes counsel that acute publicity to Gb3 induces mechanical allodynia through activation of the proNGF-p75NTR pathway, which includes lipid rafts and PKA. Our findings present new pathological insights into FD-associated ache, and counsel the necessity to develop therapeutic interventions concentrating on proNGF-p75NTR signaling.

Results of NGF Addition on Llama ( Lama glama) Sperm Traits After Cooling

To offer new insights into the mechanisms via which seminal plasma proteins can defend sperm from harm induced throughout refrigeration, we consider the likelihood that β-NGF can contribute to the advance of sperm high quality after cooling. First, β-NGF was detected in refrigerated sperm and in contrast with unrefrigerated sperm by western blotting of the proteins adsorbed by sperm, displaying that native β-NGF continues to be current even 24 h after cooling solely as an energetic kind.

Then, the impact of exogenous β-NGF on sperm high quality after cooling was evaluated. A complete of 12 ejaculates from male llamas (three ejaculates per male), have been obtained by electro-ejaculation, diluted 4:1 with buffer Hepes-balanced salt answer and centrifuged at 800 × g for eight min to take away the seminal plasma. Sperm have been suspended in Tris-citrate-fructose-egg yolk diluent for a last focus of 30 ×106/ml and cooled at 5°C for 24 h.

After refrigeration, the prolonged sperm have been equilibrated for five min at 37°C and divided into the next subgroups: sperm samples with out remedy (management) and sperm samples supplemented with exogenous human β-NGF (10, 100, and 500 ng/ml). At 5, 30, and 60 min of incubation sperm have been evaluated for sperm viability (utilizing eosin/nigrosin stain), sperm motility and vigor (noticed underneath gentle microscopy), and mitochondrial exercise (utilizing the JC-1 fluorescent marker).

Vigor information have been analyzed with the nonparametric Kruskal-Wallis take a look at. The remainder of the variables have been analyzed with a blended fashions method. Imply comparisons have been carried out utilizing Fisher’s LSD take a look at with a confidence stage of 95%. A principal parts evaluation was carried out to investigate the relationships between variables.

Remedy of 24 h cooled sperm with 10 or 100 ng/ml of human β-NGF elevated the share of whole motility and vigor (p < 0.05). Moreover, an incubation time of 60 min can be ample to enhance sperm high quality, since all variables are positively associated. The numerous enchancment noticed within the motility and vigor of post-refrigerated sperm means that supplementation with exogenous β-NGF could also be worthwhile for the advance of cooled llama sperm.

Fabry disease-associated globotriaosylceramide induces mechanical allodynia via activation of signaling through proNGF-p75 NTR but not mature NGF-TrkA

BmK NSPK, a Potent Potassium Channel Inhibitor from Scorpion Buthus martensii Karsch, Promotes Neurite Outgrowth through NGF/TrkA Signaling Pathway

Scorpion toxins signify a wide range of instruments to discover molecular mechanisms and mobile signaling pathways of many organic capabilities. These toxins are additionally promising lead compounds for growing therapies for a lot of neurological ailments. Within the present research, we purified a brand new scorpion toxin designated as BmK NSPK (Buthus martensii Karsch neurite-stimulating peptide concentrating on Okayv channels) from the BmK venom. The first construction was decided utilizing Edman degradation.

BmK NSPK straight inhibited outward Okay+ present with out affecting sodium channel actions, depolarized membrane, and elevated spontaneous calcium oscillation in spinal twine neurons (SCNs) at low nanomolar concentrations. BmK NSPK produced a nonmonotonic enhance on the neurite extension that peaked at ~10 nM. Mechanistic research demonstrated that BmK NSPK elevated the discharge of nerve development issue (NGF).

The tyrosine kinases A (TrkA) receptor inhibitor, GW 441756, eradicated the BmK NSPK-induced neurite outgrowth. BmK NSPK additionally elevated phosphorylation ranges of protein kinase B (Akt) that’s the downstream regulator of TrkA receptors.

Human Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-Hu-48T 48T
EUR 331
  • Should the Human Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-Hu-96T 96T
EUR 418
  • Should the Human Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-Mu-48T 48T
EUR 435
  • Should the Mouse Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-Mu-96T 96T
EUR 561
  • Should the Mouse Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-p-48T 48T
EUR 547
  • Should the Porcine Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-p-96T 96T
EUR 715
  • Should the Porcine Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-Ra-48T 48T
EUR 454
  • Should the Rat Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-Ra-96T 96T
EUR 587
  • Should the Rat Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-Rb-48T 48T
EUR 454
  • Should the Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit

DLR-HGF-Rb-96T 96T
EUR 587
  • Should the Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-b-48Tests 48 Tests
EUR 516

Bovine Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-b-96Tests 96 Tests
EUR 716

Canine Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-c-48Tests 48 Tests
EUR 493

Canine Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-c-96Tests 96 Tests
EUR 683

Human Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-Hu-48Tests 48 Tests
EUR 325

Human Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-Hu-96Tests 96 Tests
EUR 442

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-Mu-48Tests 48 Tests
EUR 447

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-Mu-96Tests 96 Tests
EUR 618

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-p-48Tests 48 Tests
EUR 580

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-p-96Tests 96 Tests
EUR 807

Rat Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-Ra-48Tests 48 Tests
EUR 470

Rat Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-Ra-96Tests 96 Tests
EUR 651

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-Rb-48Tests 48 Tests
EUR 470

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit

RDR-HGF-Rb-96Tests 96 Tests
EUR 651

Bovine Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-b-48Tests 48 Tests
EUR 494

Bovine Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-b-96Tests 96 Tests
EUR 684

Canine Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-c-48Tests 48 Tests
EUR 472

Canine Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-c-96Tests 96 Tests
EUR 653

Human Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-Hu-48Tests 48 Tests
EUR 311

Human Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-Hu-96Tests 96 Tests
EUR 424

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-Mu-48Tests 48 Tests
EUR 429

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-Mu-96Tests 96 Tests
EUR 591

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-p-48Tests 48 Tests
EUR 555

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-p-96Tests 96 Tests
EUR 771

Rat Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-Ra-48Tests 48 Tests
EUR 450

Rat Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-Ra-96Tests 96 Tests
EUR 622

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-Rb-48Tests 48 Tests
EUR 450

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit

RD-HGF-Rb-96Tests 96 Tests
EUR 622

HGF antibody

70R-11547 100 ug
EUR 532
Description: Rabbit polyclonal HGF antibody

HGF antibody

70R-13854 100 ug
EUR 322
Description: Affinity purified Goat polyclonal HGF antibody

HGF Antibody

32218-100ul 100ul
EUR 252

HGF antibody

10R-H138A 500 ug
EUR 1377
Description: Mouse monoclonal HGF antibody

HGF antibody

10-2526 250 ug
EUR 492
Description: Mouse monoclonal HGF antibody

HGF Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HGF. Recognizes HGF from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

HGF Antibody

DF6326 200ul
EUR 304
Description: HGF Antibody detects endogenous levels of total HGF.

HGF Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HGF. Recognizes HGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

HGF Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HGF. Recognizes HGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

HGF antibody

70R-HG004 100 ug
EUR 824
Description: Affinity purified Goat polyclonal HGF antibody

HGF antibody

70R-6637 50 ug
EUR 467
Description: Rabbit polyclonal HGF antibody

HGF antibody

70R-8599 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal HGF antibody

HGF antibody

70R-5700 50 ug
EUR 467
Description: Rabbit polyclonal HGF antibody

HGF Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HGF. Recognizes HGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:200-1:500, IHC:1:50-1:100

HGF Antibody

CSB-PA010327KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HGF. Recognizes HGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:200-1:500, IHC:1:50-1:100

HGF Antibody

ABD6326 100 ug
EUR 438


GT15204 100 ug
EUR 526

Human HGF Antibody

32740-05111 150 ug
EUR 261

HGF antibody (biotin)

60R-HG003BT 100 ug
EUR 804
Description: Goat polyclonal HGF antibody (biotin) conjugated

HGF activator Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

HGF Conjugated Antibody

C32218 100ul
EUR 397

HGF Polyclonal Antibody

ABP57387-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human HGF
  • Applications tips:
Description: A polyclonal antibody for detection of HGF from Human. This HGF antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HGF

HGF Polyclonal Antibody

ABP57387-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human HGF
  • Applications tips:
Description: A polyclonal antibody for detection of HGF from Human. This HGF antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HGF

HGF Polyclonal Antibody

ABP57387-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human HGF
  • Applications tips:
Description: A polyclonal antibody for detection of HGF from Human. This HGF antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HGF

HGF Polyclonal Antibody

ES8380-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HGF from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HGF Polyclonal Antibody

ES8380-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HGF from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-HGF Antibody

PA1312 100ug/vial
EUR 334

Anti-HGF Antibody

PB9084 100ug/vial
EUR 334

Anti-HGF Antibody

RP1062 100ug/vial
EUR 294

Anti-HGF antibody

STJ23940 100 µl
EUR 277
Description: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. This protein is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. This protein also plays a role in angiogenesis, tumorogenesis, and tissue regeneration. Although the encoded protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Mutations in this gene are associated with nonsyndromic hearing loss.

Anti-HGF antibody

STJ97652 200 µl
EUR 197
Description: Rabbit polyclonal to HGF.


ELA-E0047r 96 Tests
EUR 886

HGF protein

30R-2623 10 ug
EUR 340
Description: Purified recombinant Human HGF protein

HGF protein

30R-2624 10 ug
EUR 317
Description: Purified recombinant Human HGF protein

HGF protein

30R-AH020 10 ug
EUR 273
Description: Purified recombinant Human HGF protein

HGF protein

30R-AH025 5 ug
EUR 242
Description: Purified recombinant Human HGF protein


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HGF Human

PR15061 5 ug
EUR 481


PR27049 2 ug
EUR 191

HGF Human

PR27050 2 ug
EUR 191


YF-PA12302 100 ug
EUR 403
Description: Rabbit polyclonal to HGF


YF-PA23875 50 ul
EUR 334
Description: Mouse polyclonal to HGF

Human HGF Antibody (Biotin Conjugate)

32740-05121 150 ug
EUR 369

Hepatocyte Growth Factor (HGF) Antibody

abx025436-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody

abx025437-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody

abx025437-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 1288.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 843.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 843.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 843.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 356.00
  • EUR 940.00
  • EUR 481.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody

abx117058-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatocyte Growth Factor (HGF) Antibody

abx029391-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody

abx029391-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal HGF Antibody, Clone: 489CT6.12.6

AMM02413G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human HGF. The antibodies are raised in Mouse and are from clone 489CT6.12.6. This antibody is applicable in WB, E

Hepatocyte Growth Factor (HGF) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

HGF Rabbit pAb

A1193-100ul 100 ul
EUR 308

HGF Rabbit pAb

A1193-200ul 200 ul
EUR 459

HGF Rabbit pAb

A1193-20ul 20 ul
EUR 183

HGF Rabbit pAb

A1193-50ul 50 ul
EUR 223

HGF Blocking Peptide

33R-3251 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HGF antibody, catalog no. 70R-5700

HGF Blocking Peptide

33R-9625 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HGF antibody, catalog no. 70R-6637

HGF, human recombinant

EUR 278

HGF, human recombinant

EUR 8614

HGF, human recombinant

EUR 278

HGF, human recombinant

EUR 8614

HGF, human recombinant

EUR 958

HGF Blocking Peptide

DF6326-BP 1mg
EUR 195

HGF, murine recombinant

EUR 240

HGF, murine recombinant

EUR 860

HGF Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HGF cloning plasmid

CSB-CL010327HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 633
  • Sequence: atgtgggtgaccaaactcctgccagccctgctgctgcagcatgtcctcctgcatctcctcctgctccccatcgccatcccctatgcagagggacaaaggaaaagaagaaatacaattcatgaattcaagaaatcagcaaagactaccctaatcaaaatagatccagcactgaagat
  • Show more
Description: A cloning plasmid for the HGF gene.

HGF cloning plasmid

CSB-CL010327HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgtgggtgaccaaactcctgccagccctgctgctgcagcatgtcctcctgcatctcctcctgctccccatcgccatcccctatgcagagggacaaaggaaaagaagaaatacaattcatgaattcaaaaaatcagcaaagactaccctaatcaaaatagatccagcactgaagat
  • Show more
Description: A cloning plasmid for the HGF gene.

HGF cloning plasmid

CSB-CL010327HU3-10ug 10ug
EUR 721
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2187
  • Sequence: atgtgggtgaccaaactcctgccagccctgctgctgcagcatgtcctcctgcatctcctcctgctccccatcgccatcccctatgcagagggacaaaggaaaagaagaaatacaattcatgaattcaaaaaatcagcaaagactaccctaatcaaaatagatccagcactgaaga
  • Show more
Description: A cloning plasmid for the HGF gene.

Human HGF AssayLite Antibody (FITC Conjugate)

32740-05141 150 ug
EUR 428

Human HGF AssayLite Antibody (RPE Conjugate)

32740-05151 150 ug
EUR 428

Human HGF AssayLite Antibody (APC Conjugate)

32740-05161 150 ug
EUR 428

Human HGF AssayLite Antibody (PerCP Conjugate)

32740-05171 150 ug
EUR 471

Hepatocyte Growth Factor (HGF) Antibody (APC)

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatocyte Growth Factor (HGF) Antibody (Biotin)

  • EUR 328.00
  • EUR 217.00
  • EUR 913.00
  • EUR 467.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody Pair

  • EUR 1191.00
  • EUR 787.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody (FITC)

  • EUR 342.00
  • EUR 217.00
  • EUR 982.00
  • EUR 495.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody (APC)

  • EUR 425.00
  • EUR 230.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human HGF ELISA kit

55R-1586 1 kit
EUR 503
Description: ELISA kit for the detection of Human HGF in the research laboratory

Mouse HGF ELISA kit

55R-2088 96 tests
EUR 712
Description: ELISA Kit for detection of Hepatocyte Growth Factor in the research laboratory

Human HGF ELISA kit

55R-2128 96 tests
EUR 766
Description: ELISA Kit for detection of HGF in the research laboratory

HGF protein (His tag)

80R-3851 100 ug
EUR 327
Description: Purified recombinant HGF protein (His tag)

HGF activator Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


ELA-E0047h 96 Tests
EUR 824


EHH0215 96Tests
EUR 521


EGTH0215 96Tests
EUR 521

Bovine HGF ELISA Kit

EBH0215 96Tests
EUR 521

Canine HGF ELISA Kit

ECH0215 96Tests
EUR 521

Chicken HGF ELISA Kit

ECKH0215 96Tests
EUR 521

Anserini HGF ELISA Kit

EAH0215 96Tests
EUR 521


EF000130 96 Tests
EUR 689

Rat HGF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HGF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HGF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HGF (CHO-expressed), Human

HY-P7121 10ug
EUR 223


ERH0215 96Tests
EUR 521


ESH0215 96Tests
EUR 521

HGF (human) ELISA Kit

K4781-100 100 assays
EUR 834
  • Kit components:
  • HGF Microplate (Item A) coated with anti-human HGF, 96 wells
  • Wash Buffer Concentrate (20x) (Item B)
  • Standards (Item C) (recombinant human HGF)
  • Assay Diluent A (Item D) for Standard/Sample (serum/plasma) diluent (0.09% sodium a
  • Show more
Description: Sensitive, Colorimetric Assay

Rabbit HGF ELISA Kit

ERTH0215 96Tests
EUR 521


EMH0215 96Tests
EUR 521

Monkey HGF ELISA Kit

EMKH0215 96Tests
EUR 521

Porcine HGF ELISA Kit

EPH0215 96Tests
EUR 521

Human HGF ELISA kit

LF-EK50065 1×96T
EUR 648

Recombinant Murine HGF Protein

PROTQ08048 20ug
EUR 317
Description: HGF is a mesenchymally derived potent mitogen for mature parenchymal hepatocyte cells and acts as a growth factor for a broad spectrum of tissues and cell types. HGF signals through a transmembrane tyrosine kinase receptor known as MET. Activities of HGF include induction of cell proliferation, motility, morphogenesis, inhibition of cell growth, and enhancement of neuron survival. HGF is a crucial mitogen for liver regeneration processes, especially after partial hepatectomy and other liver injuries. Human and murine HGF are cross-reactive. Murine HGF is expressed as a linear 728 amino acid polypeptide precursor glycoprotein. Proteolytic processing of this precursor generates the biologically active form of HGF, which consists of two polypeptide chains (α-chain and β-chain) held by a single disulfide bond resulting in formation of a biologically active heterodimer. The α-chain consists of 463 amino acid residues and four kringle domains. The β-chain consists of 233 amino acid residues. *Manufactured using (BTI-Tn-5B1-4) cells under license from the Boyce Thompson Institute for Plant Research, Inc.

Recombinant Human HGF Protein

PROTP14210-6 10ug
EUR 317
Description: HGF is a mesenchymally derived potent mitogen for mature parenchymal hepatocyte cells and acts as a growth factor for a broad spectrum of tissues and cell types. HGF signals through a transmembrane tyrosine kinase receptor known as MET. Activities of HGF include induction of cell proliferation, motility, morphogenesis, inhibition of cell growth, and enhancement of neuron survival. HGF is a crucial mitogen for liver regeneration processes, especially after partial hepatectomy and other liver injuries. Human and murine HGF are cross-reactive. Human HGF is expressed as a linear 697 amino acid polypeptide precursor glycoprotein. Proteolytic processing of this precursor generates the biologically active form of HGF, which consists of two polypeptide chains (α-chain and β-chain) held by a single disulfide bond resulting in formation of a biologically active heterodimer. The α-chain consists of 463 amino acid residues and four kringle domains. The β-chain consists of 234 amino acid residues.*Manufactured using (BTI-Tn-5B1-4) cells under license from Boyce Thompson Institute for Plant Research, Inc.


RK00091 96 Tests
EUR 521


RK00371 96 Tests
EUR 521


STJ150064 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HGF in Rat serum, plasma and other biological fluids


STJ150246 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HGF in human serum, plasma and other biological fluids

Anti-HGF/SF Monoclonal Antibody (7-2)

M00089 100ug
EUR 432
Description: Mouse Monoclonal HGF/SF Antibody (7-2). Validated in IHC, WB and tested in Human, Mouse.

Hepatocyte Growth Factor (HGF) Monoclonal Antibody (Human)

  • EUR 221.00
  • EUR 2114.00
  • EUR 535.00
  • EUR 274.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val495~Ser728
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Dog)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGF (Val495~Ser730)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Human)

  • EUR 196.00
  • EUR 1704.00
  • EUR 442.00
  • EUR 236.00
  • EUR 191.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGF (Val495~Ser728)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Human)

  • EUR 196.00
  • EUR 1704.00
  • EUR 442.00
  • EUR 236.00
  • EUR 191.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGF (Gln32~Asn291)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Human)

  • EUR 196.00
  • EUR 1704.00
  • EUR 442.00
  • EUR 236.00
  • EUR 191.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGF (Val495~Ser728)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGF (Asp482~Val710)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGF (Cys306~Glu471)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hepatocyte Growth Factor (HGF)

Human CellExp? HGF, Human Recombinant

EUR 387

Human CellExp? HGF, Human Recombinant

EUR 1398

Rat Hepatocyte growth factor (Hgf)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hepatocyte growth factor(Hgf),partial expressed in E.coli

ELISA kit for Human HGF

EK5151 96 tests
EUR 519
Description: Enzyme-linked immunosorbent assay kit for quantification of Human HGF in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse HGF

EK5535 96 tests
EUR 519
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse HGF in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat HGF

EK5586 96 tests
EUR 519
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat HGF in samples from serum, plasma, tissue homogenates and other biological fluids.

Human HGF PicoKine ELISA Kit

EK0369 96 wells
EUR 425
Description: For quantitative detection of human HGF in cell culture supernates, serum and plasma(EDTA, citrate).

Mouse HGF PicoKine ELISA Kit

EK1217 96 wells
EUR 425
Description: For quantitative detection of mouse HGF in cell culture supernates, serum and plasma(EDTA, citrate).

Rat HGF PicoKine ELISA Kit

EK1301 96 wells
EUR 425
Description: For quantitative detection of rat HGF in cell culture supernates, serum and plasma(EDTA, citrate).

Guinea Pig HGF ELISA Kit

EGH0215 96Tests
EUR 521

ELISA kit for Human HGF

KET6009-48T 48T
EUR 202
  • HGF gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of w
  • Show more
Description: Quantitative sandwich ELISA for measuring Human HGF in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human HGF

KET6009-5platesof96wells 5 plates of 96 wells
EUR 1077
  • HGF gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of w
  • Show more
Description: Quantitative sandwich ELISA for measuring Human HGF in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human HGF

KET6009-96T 96T
EUR 289
  • HGF gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of w
  • Show more
Description: Quantitative sandwich ELISA for measuring Human HGF in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human HGF ELISA kit (4X96T)

LF-EK50066 4×96T
EUR 2201

Hgf ORF Vector (Rat) (pORF)

ORF068174 1.0 ug DNA
EUR 506

h HGF inducible lentiviral particles

LVP615 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: HGF (hepatocyte growth factor ), [alternative names: DFNB39; F-TCF; HGFB; HPTA; SF]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000601.4. It also contains a RFP-Blasticidin dual selection marker.

HGF ORF Vector (Human) (pORF)

ORF004875 1.0 ug DNA
EUR 95

HGF ORF Vector (Human) (pORF)

ORF004876 1.0 ug DNA
EUR 95

HGF ORF Vector (Human) (pORF)

ORF013253 1.0 ug DNA
EUR 354

Hgf ORF Vector (Mouse) (pORF)

ORF047134 1.0 ug DNA
EUR 506

Recombinant Hepatocyte Growth Factor (HGF)

  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q867B7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Hepatocyte Growth Factor expressed in: E.coli

Recombinant Hepatocyte Growth Factor (HGF)

  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • EUR 772.00
  • EUR 1444.00
  • EUR 490.00
  • EUR 5140.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P14210
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.7kDa
  • Isoelectric Point: 9
Description: Recombinant Human Hepatocyte Growth Factor expressed in: E.coli

Recombinant Hepatocyte Growth Factor (HGF)

  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • EUR 772.00
  • EUR 1444.00
  • EUR 490.00
  • EUR 5140.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P14210
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 62.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hepatocyte Growth Factor expressed in: E.coli

Recombinant Hepatocyte Growth Factor (HGF)

  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • EUR 772.00
  • EUR 1444.00
  • EUR 490.00
  • EUR 5140.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P14210
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hepatocyte Growth Factor expressed in: E.coli

Recombinant Hepatocyte Growth Factor (HGF)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q08048
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.5kDa
  • Isoelectric Point: 8.3
Description: Recombinant Mouse Hepatocyte Growth Factor expressed in: E.coli

These information show that BmK NSPK is a brand new voltage-gated potassium (Okayv) channel inhibitor that augments neurite extension through NGF/TrkA signaling pathway. Okayv channels could signify molecular targets to modulate SCN improvement and regeneration and to develop the therapies for spinal twine damage.

Leave a Reply

Your email address will not be published. Required fields are marked *