Aria Neurosciences

Fabry disease-associated globotriaosylceramide induces mechanical allodynia via activation of signaling through proNGF-p75 NTR but not mature NGF-TrkA

Fabry illness (FD) is an X-linked metabolic storage dysfunction arising from the deficiency of lysosomal α-galactosidase A, which ends up in the gradual accumulation of glycosphingolipids, primarily globotriaosylceramide (Gb3), all through the physique. Ache within the extremities is an early symptom of FD; nevertheless, the underlying pathophysiological mechanisms stay unknown. α-Galactosidase A knockout animals exhibit nociceptive behaviors, with enhanced expression ranges of a number of ion channels.

These traits are noticed in animals handled with nerve development issue (NGF). Right here, we aimed to elucidate the potential of NGF signaling as a reason behind FD-associated ache, utilizing intraplantar Gb3-treated mice displaying mechanical allodynia. Remedy with a neutralizing antibody towards a precursor of NGF (proNGF) or its receptor, p75 neurotrophin receptor (p75^NTR), resulted within the restoration from Gb3-induced ache.

Conversely, anti-NGF and anti-tropomyosin receptor kinase A antibodies did not exert analgesic results. Gb3 injection had no results on the expression ranges of proNGF and p75^NTR within the plantar pores and skin and dorsal root ganglia, suggesting that Gb3 prompts the ache pathway, presumably mediated via useful up-regulation of proNGF-p75^NTR signaling.

Moreover, by pharmacological approaches utilizing a protein kinase A (PKA) inhibitor and a cholesterol-removing agent, we discovered that p75^NTR-phosphorylating PKA and lipid rafts for phosphorylated p75^NTR translocation have been required for Gb3-induced ache. These outcomes counsel that acute publicity to Gb3 induces mechanical allodynia through activation of the proNGF-p75^NTR pathway, which includes lipid rafts and PKA. Our findings present new pathological insights into FD-associated ache, and counsel the necessity to develop therapeutic interventions concentrating on proNGF-p75^NTR signaling.

Results of NGF Addition on Llama ( Lama glama) Sperm Traits After Cooling

To offer new insights into the mechanisms via which seminal plasma proteins can defend sperm from harm induced throughout refrigeration, we consider the likelihood that β-NGF can contribute to the advance of sperm high quality after cooling. First, β-NGF was detected in refrigerated sperm and in contrast with unrefrigerated sperm by western blotting of the proteins adsorbed by sperm, displaying that native β-NGF continues to be current even 24 h after cooling solely as an energetic kind.

Then, the impact of exogenous β-NGF on sperm high quality after cooling was evaluated. A complete of 12 ejaculates from male llamas (three ejaculates per male), have been obtained by electro-ejaculation, diluted 4:1 with buffer Hepes-balanced salt answer and centrifuged at 800 × g for eight min to take away the seminal plasma. Sperm have been suspended in Tris-citrate-fructose-egg yolk diluent for a last focus of 30 ×10⁶/ml and cooled at 5°C for 24 h.

After refrigeration, the prolonged sperm have been equilibrated for five min at 37°C and divided into the next subgroups: sperm samples with out remedy (management) and sperm samples supplemented with exogenous human β-NGF (10, 100, and 500 ng/ml). At 5, 30, and 60 min of incubation sperm have been evaluated for sperm viability (utilizing eosin/nigrosin stain), sperm motility and vigor (noticed underneath gentle microscopy), and mitochondrial exercise (utilizing the JC-1 fluorescent marker).

Vigor information have been analyzed with the nonparametric Kruskal-Wallis take a look at. The remainder of the variables have been analyzed with a blended fashions method. Imply comparisons have been carried out utilizing Fisher’s LSD take a look at with a confidence stage of 95%. A principal parts evaluation was carried out to investigate the relationships between variables.

Remedy of 24 h cooled sperm with 10 or 100 ng/ml of human β-NGF elevated the share of whole motility and vigor (p < 0.05). Moreover, an incubation time of 60 min can be ample to enhance sperm high quality, since all variables are positively associated. The numerous enchancment noticed within the motility and vigor of post-refrigerated sperm means that supplementation with exogenous β-NGF could also be worthwhile for the advance of cooled llama sperm.

BmK NSPK, a Potent Potassium Channel Inhibitor from Scorpion Buthus martensii Karsch, Promotes Neurite Outgrowth through NGF/TrkA Signaling Pathway

Scorpion toxins signify a wide range of instruments to discover molecular mechanisms and mobile signaling pathways of many organic capabilities. These toxins are additionally promising lead compounds for growing therapies for a lot of neurological ailments. Within the present research, we purified a brand new scorpion toxin designated as BmK NSPK (Buthus martensii Karsch neurite-stimulating peptide concentrating on Okay_v channels) from the BmK venom. The first construction was decided utilizing Edman degradation.

BmK NSPK straight inhibited outward Okay⁺ present with out affecting sodium channel actions, depolarized membrane, and elevated spontaneous calcium oscillation in spinal twine neurons (SCNs) at low nanomolar concentrations. BmK NSPK produced a nonmonotonic enhance on the neurite extension that peaked at ~10 nM. Mechanistic research demonstrated that BmK NSPK elevated the discharge of nerve development issue (NGF).

The tyrosine kinases A (TrkA) receptor inhibitor, GW 441756, eradicated the BmK NSPK-induced neurite outgrowth. BmK NSPK additionally elevated phosphorylation ranges of protein kinase B (Akt) that’s the downstream regulator of TrkA receptors.

Human Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-Hu-48T	DL Develop	48T	EUR 331
Should the Human Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-Hu-96T	DL Develop	96T	EUR 418
Should the Human Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-Mu-48T	DL Develop	48T	EUR 435
Should the Mouse Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-Mu-96T	DL Develop	96T	EUR 561
Should the Mouse Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-p-48T	DL Develop	48T	EUR 547
Should the Porcine Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-p-96T	DL Develop	96T	EUR 715
Should the Porcine Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-Ra-48T	DL Develop	48T	EUR 454
Should the Rat Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-Ra-96T	DL Develop	96T	EUR 587
Should the Rat Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-Rb-48T	DL Develop	48T	EUR 454
Should the Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit
DLR-HGF-Rb-96T	DL Develop	96T	EUR 587
Should the Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Hepatocyte Growth Factor (HGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-b-48Tests	Reddot Biotech	48 Tests	EUR 516

Bovine Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-b-96Tests	Reddot Biotech	96 Tests	EUR 716

Canine Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-c-48Tests	Reddot Biotech	48 Tests	EUR 493

Canine Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-c-96Tests	Reddot Biotech	96 Tests	EUR 683

Human Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 325

Human Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 442

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-Mu-48Tests	Reddot Biotech	48 Tests	EUR 447

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-Mu-96Tests	Reddot Biotech	96 Tests	EUR 618

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-p-48Tests	Reddot Biotech	48 Tests	EUR 580

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-p-96Tests	Reddot Biotech	96 Tests	EUR 807

Rat Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-Ra-48Tests	Reddot Biotech	48 Tests	EUR 470

Rat Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-Ra-96Tests	Reddot Biotech	96 Tests	EUR 651

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-Rb-48Tests	Reddot Biotech	48 Tests	EUR 470

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit
RDR-HGF-Rb-96Tests	Reddot Biotech	96 Tests	EUR 651

Bovine Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-b-48Tests	Reddot Biotech	48 Tests	EUR 494

Bovine Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-b-96Tests	Reddot Biotech	96 Tests	EUR 684

Canine Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-c-48Tests	Reddot Biotech	48 Tests	EUR 472

Canine Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-c-96Tests	Reddot Biotech	96 Tests	EUR 653

Human Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 311

Human Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 424

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-Mu-48Tests	Reddot Biotech	48 Tests	EUR 429

Mouse Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-Mu-96Tests	Reddot Biotech	96 Tests	EUR 591

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-Ra-48Tests	Reddot Biotech	48 Tests	EUR 450

Rat Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-Ra-96Tests	Reddot Biotech	96 Tests	EUR 622

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-Rb-48Tests	Reddot Biotech	48 Tests	EUR 450

Rabbit Hepatocyte Growth Factor (HGF) ELISA Kit
RD-HGF-Rb-96Tests	Reddot Biotech	96 Tests	EUR 622

HGF antibody
70R-11547	Fitzgerald	100 ug	EUR 532
Description: Rabbit polyclonal HGF antibody

HGF antibody
70R-13854	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Goat polyclonal HGF antibody

HGF Antibody
32218-100ul	SAB	100ul	EUR 252

HGF antibody
10R-H138A	Fitzgerald	500 ug	EUR 1377
Description: Mouse monoclonal HGF antibody

HGF antibody
10-2526	Fitzgerald	250 ug	EUR 492
Description: Mouse monoclonal HGF antibody

HGF Antibody
1-CSB-PA783451	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HGF. Recognizes HGF from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

HGF Antibody
DF6326	Affbiotech	200ul	EUR 304
Description: HGF Antibody detects endogenous levels of total HGF.

HGF Antibody
1-CSB-PA254609	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HGF. Recognizes HGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

HGF Antibody
1-CSB-PA221214	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HGF. Recognizes HGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

HGF antibody
70R-HG004	Fitzgerald	100 ug	EUR 824
Description: Affinity purified Goat polyclonal HGF antibody

HGF antibody
70R-6637	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal HGF antibody

HGF antibody
70R-8599	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal HGF antibody

HGF antibody
70R-5700	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal HGF antibody

HGF Antibody
CSB-PA010327KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HGF. Recognizes HGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:200-1:500, IHC:1:50-1:100

HGF Antibody
CSB-PA010327KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HGF. Recognizes HGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:200-1:500, IHC:1:50-1:100

HGF Antibody
ABD6326	Lifescience Market	100 ug	EUR 438

HGF
GT15204	Neuromics	100 ug	EUR 526

Human HGF Antibody
32740-05111	AssayPro	150 ug	EUR 261

HGF antibody (biotin)
60R-HG003BT	Fitzgerald	100 ug	EUR 804
Description: Goat polyclonal HGF antibody (biotin) conjugated

HGF activator Antibody
20-abx141127	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

HGF Conjugated Antibody
C32218	SAB	100ul	EUR 397

HGF Polyclonal Antibody
ABP57387-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human HGF Applications tips:
Description: A polyclonal antibody for detection of HGF from Human. This HGF antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HGF

HGF Polyclonal Antibody
ABP57387-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human HGF Applications tips:
Description: A polyclonal antibody for detection of HGF from Human. This HGF antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HGF

HGF Polyclonal Antibody
ABP57387-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human HGF Applications tips:
Description: A polyclonal antibody for detection of HGF from Human. This HGF antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HGF

HGF Polyclonal Antibody
ES8380-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HGF from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HGF Polyclonal Antibody
ES8380-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HGF from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-HGF Antibody
PA1312	BosterBio	100ug/vial	EUR 334

Anti-HGF Antibody
PB9084	BosterBio	100ug/vial	EUR 334

Anti-HGF Antibody
RP1062	BosterBio	100ug/vial	EUR 294

Anti-HGF antibody
STJ23940	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. This protein is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. This protein also plays a role in angiogenesis, tumorogenesis, and tissue regeneration. Although the encoded protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Mutations in this gene are associated with nonsyndromic hearing loss.

Anti-HGF antibody
STJ97652	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to HGF.

HGF/ Rat HGF ELISA Kit
ELA-E0047r	Lifescience Market	96 Tests	EUR 886

HGF protein
30R-2623	Fitzgerald	10 ug	EUR 340
Description: Purified recombinant Human HGF protein

HGF protein
30R-2624	Fitzgerald	10 ug	EUR 317
Description: Purified recombinant Human HGF protein

HGF protein
30R-AH020	Fitzgerald	10 ug	EUR 273
Description: Purified recombinant Human HGF protein

HGF protein
30R-AH025	Fitzgerald	5 ug	EUR 242
Description: Purified recombinant Human HGF protein

HGF siRNA
20-abx902455	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HGF siRNA
20-abx919319	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HGF siRNA
20-abx919320	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HGF Human
PR15061	Neuromics	5 ug	EUR 481

HGF CHO
PR27049	Neuromics	2 ug	EUR 191

HGF Human
PR27050	Neuromics	2 ug	EUR 191

anti-HGF
YF-PA12302	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to HGF

anti-HGF
YF-PA23875	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to HGF

Human HGF Antibody (Biotin Conjugate)
32740-05121	AssayPro	150 ug	EUR 369

Hepatocyte Growth Factor (HGF) Antibody
abx025436-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody
abx025437-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody
abx025437-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx176817	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Hepatocyte Growth Factor (HGF) Antibody
20-abx176819	Abbexa	EUR 1288.00 EUR 620.00	1 mg 200 ug
Please enquire.

Hepatocyte Growth Factor (HGF) Antibody
20-abx102372	Abbexa	EUR 314.00 EUR 133.00 EUR 843.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx102373	Abbexa	EUR 314.00 EUR 133.00 EUR 843.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx102374	Abbexa	EUR 314.00 EUR 133.00 EUR 843.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx102375	Abbexa	EUR 356.00 EUR 940.00 EUR 481.00 EUR 154.00 EUR 272.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx102376	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx102377	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx104891	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hepatocyte Growth Factor (HGF) Antibody
abx117058-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx141201	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx172782	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Hepatocyte Growth Factor (HGF) Antibody
20-abx172783	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Hepatocyte Growth Factor (HGF) Antibody
20-abx172784	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

Hepatocyte Growth Factor (HGF) Antibody
20-abx172785	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Hepatocyte Growth Factor (HGF) Antibody
abx029391-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody
abx029391-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx241534	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx241535	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Hepatocyte Growth Factor (HGF) Antibody
20-abx323389	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Monoclonal HGF Antibody, Clone: 489CT6.12.6
AMM02413G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human HGF. The antibodies are raised in Mouse and are from clone 489CT6.12.6. This antibody is applicable in WB, E

Hepatocyte Growth Factor (HGF) Antibody
20-abx001106	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

HGF Rabbit pAb
A1193-100ul	Abclonal	100 ul	EUR 308

HGF Rabbit pAb
A1193-200ul	Abclonal	200 ul	EUR 459

HGF Rabbit pAb
A1193-20ul	Abclonal	20 ul	EUR 183

HGF Rabbit pAb
A1193-50ul	Abclonal	50 ul	EUR 223

HGF Blocking Peptide
33R-3251	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HGF antibody, catalog no. 70R-5700

HGF Blocking Peptide
33R-9625	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HGF antibody, catalog no. 70R-6637

HGF, human recombinant
4509-10	Biovision		EUR 278

HGF, human recombinant
4509-1000	Biovision		EUR 8614

HGF, human recombinant
4510-10	Biovision		EUR 278

HGF, human recombinant
4510-1000	Biovision		EUR 8614

HGF, human recombinant
4510-50	Biovision		EUR 958

HGF Blocking Peptide
DF6326-BP	Affbiotech	1mg	EUR 195

HGF, murine recombinant
7160-10	Biovision		EUR 240

HGF, murine recombinant
7160-50	Biovision		EUR 860

HGF Blocking Peptide
20-abx061899	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

HGF cloning plasmid
CSB-CL010327HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 633 Sequence: atgtgggtgaccaaactcctgccagccctgctgctgcagcatgtcctcctgcatctcctcctgctccccatcgccatcccctatgcagagggacaaaggaaaagaagaaatacaattcatgaattcaagaaatcagcaaagactaccctaatcaaaatagatccagcactgaagat Show more
Description: A cloning plasmid for the HGF gene.

HGF cloning plasmid
CSB-CL010327HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 858 Sequence: atgtgggtgaccaaactcctgccagccctgctgctgcagcatgtcctcctgcatctcctcctgctccccatcgccatcccctatgcagagggacaaaggaaaagaagaaatacaattcatgaattcaaaaaatcagcaaagactaccctaatcaaaatagatccagcactgaagat Show more
Description: A cloning plasmid for the HGF gene.

HGF cloning plasmid
CSB-CL010327HU3-10ug	Cusabio	10ug	EUR 721
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2187 Sequence: atgtgggtgaccaaactcctgccagccctgctgctgcagcatgtcctcctgcatctcctcctgctccccatcgccatcccctatgcagagggacaaaggaaaagaagaaatacaattcatgaattcaaaaaatcagcaaagactaccctaatcaaaatagatccagcactgaaga Show more
Description: A cloning plasmid for the HGF gene.

Human HGF AssayLite Antibody (FITC Conjugate)
32740-05141	AssayPro	150 ug	EUR 428

Human HGF AssayLite Antibody (RPE Conjugate)
32740-05151	AssayPro	150 ug	EUR 428

Human HGF AssayLite Antibody (APC Conjugate)
32740-05161	AssayPro	150 ug	EUR 428

Human HGF AssayLite Antibody (PerCP Conjugate)
32740-05171	AssayPro	150 ug	EUR 471

Hepatocyte Growth Factor (HGF) Antibody (APC)
20-abx176818	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Hepatocyte Growth Factor (HGF) Antibody (Biotin)
20-abx271900	Abbexa	EUR 328.00 EUR 217.00 EUR 913.00 EUR 467.00 EUR 286.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody (Biotin)
20-abx273129	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody Pair
20-abx370089	Abbexa	EUR 1191.00 EUR 787.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody (FITC)
20-abx273861	Abbexa	EUR 342.00 EUR 217.00 EUR 982.00 EUR 495.00 EUR 286.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody (FITC)
20-abx274174	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Hepatocyte Growth Factor (HGF) Antibody (APC)
20-abx274635	Abbexa	EUR 425.00 EUR 230.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human HGF ELISA kit
55R-1586	Fitzgerald	1 kit	EUR 503
Description: ELISA kit for the detection of Human HGF in the research laboratory

Mouse HGF ELISA kit
55R-2088	Fitzgerald	96 tests	EUR 712
Description: ELISA Kit for detection of Hepatocyte Growth Factor in the research laboratory

Human HGF ELISA kit
55R-2128	Fitzgerald	96 tests	EUR 766
Description: ELISA Kit for detection of HGF in the research laboratory

HGF protein (His tag)
80R-3851	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant HGF protein (His tag)

HGF activator Blocking Peptide
20-abx061825	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

Human HGF ELISA Kit
ELA-E0047h	Lifescience Market	96 Tests	EUR 824

Human HGF ELISA Kit
EHH0215	Abclonal	96Tests	EUR 521

Goat HGF ELISA Kit
EGTH0215	Abclonal	96Tests	EUR 521

Bovine HGF ELISA Kit
EBH0215	Abclonal	96Tests	EUR 521

Canine HGF ELISA Kit
ECH0215	Abclonal	96Tests	EUR 521

Chicken HGF ELISA Kit
ECKH0215	Abclonal	96Tests	EUR 521

Anserini HGF ELISA Kit
EAH0215	Abclonal	96Tests	EUR 521

HGF ELISA KIT|Human
EF000130	Lifescience Market	96 Tests	EUR 689

Rat HGF shRNA Plasmid
20-abx984496	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HGF shRNA Plasmid
20-abx952100	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse HGF shRNA Plasmid
20-abx970796	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HGF (CHO-expressed), Human
HY-P7121	MedChemExpress	10ug	EUR 223

Rat HGF ELISA Kit
ERH0215	Abclonal	96Tests	EUR 521

Sheep HGF ELISA Kit
ESH0215	Abclonal	96Tests	EUR 521

HGF (human) ELISA Kit
K4781-100	Biovision	100 assays	EUR 834
Kit components: HGF Microplate (Item A) coated with anti-human HGF, 96 wells Wash Buffer Concentrate (20x) (Item B) Standards (Item C) (recombinant human HGF) Assay Diluent A (Item D) for Standard/Sample (serum/plasma) diluent (0.09% sodium a Show more
Description: Sensitive, Colorimetric Assay

Rabbit HGF ELISA Kit
ERTH0215	Abclonal	96Tests	EUR 521

Mouse HGF ELISA Kit
EMH0215	Abclonal	96Tests	EUR 521

Monkey HGF ELISA Kit
EMKH0215	Abclonal	96Tests	EUR 521

Porcine HGF ELISA Kit
EPH0215	Abclonal	96Tests	EUR 521

Human HGF ELISA kit
LF-EK50065	Abfrontier	1×96T	EUR 648

Recombinant Murine HGF Protein
PROTQ08048	BosterBio	20ug	EUR 317
Description: HGF is a mesenchymally derived potent mitogen for mature parenchymal hepatocyte cells and acts as a growth factor for a broad spectrum of tissues and cell types. HGF signals through a transmembrane tyrosine kinase receptor known as MET. Activities of HGF include induction of cell proliferation, motility, morphogenesis, inhibition of cell growth, and enhancement of neuron survival. HGF is a crucial mitogen for liver regeneration processes, especially after partial hepatectomy and other liver injuries. Human and murine HGF are cross-reactive. Murine HGF is expressed as a linear 728 amino acid polypeptide precursor glycoprotein. Proteolytic processing of this precursor generates the biologically active form of HGF, which consists of two polypeptide chains (α-chain and β-chain) held by a single disulfide bond resulting in formation of a biologically active heterodimer. The α-chain consists of 463 amino acid residues and four kringle domains. The β-chain consists of 233 amino acid residues. *Manufactured using (BTI-Tn-5B1-4) cells under license from the Boyce Thompson Institute for Plant Research, Inc.

Recombinant Human HGF Protein
PROTP14210-6	BosterBio	10ug	EUR 317
Description: HGF is a mesenchymally derived potent mitogen for mature parenchymal hepatocyte cells and acts as a growth factor for a broad spectrum of tissues and cell types. HGF signals through a transmembrane tyrosine kinase receptor known as MET. Activities of HGF include induction of cell proliferation, motility, morphogenesis, inhibition of cell growth, and enhancement of neuron survival. HGF is a crucial mitogen for liver regeneration processes, especially after partial hepatectomy and other liver injuries. Human and murine HGF are cross-reactive. Human HGF is expressed as a linear 697 amino acid polypeptide precursor glycoprotein. Proteolytic processing of this precursor generates the biologically active form of HGF, which consists of two polypeptide chains (α-chain and β-chain) held by a single disulfide bond resulting in formation of a biologically active heterodimer. The α-chain consists of 463 amino acid residues and four kringle domains. The β-chain consists of 234 amino acid residues.*Manufactured using (BTI-Tn-5B1-4) cells under license from Boyce Thompson Institute for Plant Research, Inc.

Human HGF ELISA Kit
RK00091	Abclonal	96 Tests	EUR 521

Mouse HGF ELISA Kit
RK00371	Abclonal	96 Tests	EUR 521

Rat HGF ELISA Kit
STJ150064	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HGF in Rat serum, plasma and other biological fluids

Human HGF ELISA Kit
STJ150246	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HGF in human serum, plasma and other biological fluids

Anti-HGF/SF Monoclonal Antibody (7-2)
M00089	BosterBio	100ug	EUR 432
Description: Mouse Monoclonal HGF/SF Antibody (7-2). Validated in IHC, WB and tested in Human, Mouse.

Hepatocyte Growth Factor (HGF) Monoclonal Antibody (Human)
4-MAA047Hu22	Cloud-Clone	EUR 221.00 EUR 2114.00 EUR 535.00 EUR 274.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val495~Ser728 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Dog)
4-PAA047Ca01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGF (Val495~Ser730) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Human)
4-PAA047Hu01	Cloud-Clone	EUR 196.00 EUR 1704.00 EUR 442.00 EUR 236.00 EUR 191.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGF (Val495~Ser728) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Human)
4-PAA047Hu02	Cloud-Clone	EUR 196.00 EUR 1704.00 EUR 442.00 EUR 236.00 EUR 191.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGF (Gln32~Asn291) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Human)
4-PAA047Hu03	Cloud-Clone	EUR 196.00 EUR 1704.00 EUR 442.00 EUR 236.00 EUR 191.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGF (Val495~Ser728) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Mouse)
4-PAA047Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGF (Asp482~Val710) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hepatocyte Growth Factor (HGF)

Hepatocyte Growth Factor (HGF) Polyclonal Antibody (Rat)
4-PAA047Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGF (Cys306~Glu471) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hepatocyte Growth Factor (HGF)

Human CellExp? HGF, Human Recombinant
6456-10	Biovision		EUR 387

Human CellExp? HGF, Human Recombinant
6456-50	Biovision		EUR 1398

Rat Hepatocyte growth factor (Hgf)
1-CSB-RP084844R	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hepatocyte growth factor(Hgf),partial expressed in E.coli

ELISA kit for Human HGF
EK5151	SAB	96 tests	EUR 519
Description: Enzyme-linked immunosorbent assay kit for quantification of Human HGF in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse HGF
EK5535	SAB	96 tests	EUR 519
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse HGF in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat HGF
EK5586	SAB	96 tests	EUR 519
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat HGF in samples from serum, plasma, tissue homogenates and other biological fluids.

Human HGF PicoKine ELISA Kit
EK0369	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human HGF in cell culture supernates, serum and plasma(EDTA, citrate).

Mouse HGF PicoKine ELISA Kit
EK1217	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse HGF in cell culture supernates, serum and plasma(EDTA, citrate).

Rat HGF PicoKine ELISA Kit
EK1301	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat HGF in cell culture supernates, serum and plasma(EDTA, citrate).

Guinea Pig HGF ELISA Kit
EGH0215	Abclonal	96Tests	EUR 521

ELISA kit for Human HGF
KET6009-48T	Abbkine	48T	EUR 202
HGF gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of w Show more
Description: Quantitative sandwich ELISA for measuring Human HGF in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human HGF
KET6009-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 1077
HGF gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of w Show more
Description: Quantitative sandwich ELISA for measuring Human HGF in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human HGF
KET6009-96T	Abbkine	96T	EUR 289
HGF gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of w Show more
Description: Quantitative sandwich ELISA for measuring Human HGF in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human HGF ELISA kit (4X96T)
LF-EK50066	Abfrontier	4×96T	EUR 2201

Hgf ORF Vector (Rat) (pORF)
ORF068174	ABM	1.0 ug DNA	EUR 506

h HGF inducible lentiviral particles
LVP615	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: HGF (hepatocyte growth factor ), [alternative names: DFNB39; F-TCF; HGFB; HPTA; SF]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000601.4. It also contains a RFP-Blasticidin dual selection marker.

HGF ORF Vector (Human) (pORF)
ORF004875	ABM	1.0 ug DNA	EUR 95

HGF ORF Vector (Human) (pORF)
ORF004876	ABM	1.0 ug DNA	EUR 95

HGF ORF Vector (Human) (pORF)
ORF013253	ABM	1.0 ug DNA	EUR 354

Hgf ORF Vector (Mouse) (pORF)
ORF047134	ABM	1.0 ug DNA	EUR 506

Recombinant Hepatocyte Growth Factor (HGF)
4-RPA047Ca01	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q867B7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.0kDa Isoelectric Point: Inquire
Description: Recombinant Dog Hepatocyte Growth Factor expressed in: E.coli

Recombinant Hepatocyte Growth Factor (HGF)
4-RPA047Hu01	Cloud-Clone	EUR 637.60 EUR 274.00 EUR 2116.00 EUR 772.00 EUR 1444.00 EUR 490.00 EUR 5140.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P14210 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.7kDa Isoelectric Point: 9
Description: Recombinant Human Hepatocyte Growth Factor expressed in: E.coli

Recombinant Hepatocyte Growth Factor (HGF)
4-RPA047Hu02	Cloud-Clone	EUR 637.60 EUR 274.00 EUR 2116.00 EUR 772.00 EUR 1444.00 EUR 490.00 EUR 5140.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P14210 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 62.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Hepatocyte Growth Factor expressed in: E.coli

Recombinant Hepatocyte Growth Factor (HGF)
4-RPA047Hu03	Cloud-Clone	EUR 637.60 EUR 274.00 EUR 2116.00 EUR 772.00 EUR 1444.00 EUR 490.00 EUR 5140.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P14210 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Hepatocyte Growth Factor expressed in: E.coli

Recombinant Hepatocyte Growth Factor (HGF)
4-RPA047Mu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q08048 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.5kDa Isoelectric Point: 8.3
Description: Recombinant Mouse Hepatocyte Growth Factor expressed in: E.coli

These information show that BmK NSPK is a brand new voltage-gated potassium (Okay_v) channel inhibitor that augments neurite extension through NGF/TrkA signaling pathway. Okay_v channels could signify molecular targets to modulate SCN improvement and regeneration and to develop the therapies for spinal twine damage.